Gene Bridges 
 

Home | Company | Distributors | Contact

Back Back to list

Quick & Easy BAC Modification Kit

For all types of BAC modifications.

Manual [PDF]      Contact Support      Order      Sequences

Features

  • Fast and reliable cloning of large DNA molecules
  • Precise DNA modification at position of choice
  • Independent of restriction sites
  • No size limitation

Applications

  • Simple BAC modification like insertion of a selection marker, deletion of a fragment with a selection marker gene, insertion of a function fragment together with selection marker gene
  • This kit can also be applied on bacterial chromosome modification

Overview of one-step insertion of a selectable marker gene

1. Transformation of BAC host withRed/ET
In a first step the Red/ET plasmid pSC101-BAD-gbaA is transferred into the E.coli host that contains the BAC.

2. BAC Modification by Red/ET
The expression of genes mediating Red/ET is induced by adding L-arabinose and a temperature shift from 30°C to 37°C. After induction the cells are prepared for electroporation and the PCR product with the added homology arms is electroporated.

3. Selection & Extraction of the modified BAC DNA
Select for the antibiotic resistance conveyed by the selectable marker in the PCR product to identify colonies carrying successfully modified BACs. A subsequent DNA mini preparation is used to confirm the desired BAC modification.

Description

This kit is designed to modify BACs with the revolutionary Red/ET Recombination technology - a powerful tool for introducing modifications such as insertions and deletions into any type of BAC within 2 weeks. Red/ET Recombination uses in vivo recombination and proofreading activity to minimize unwanted mutations in your construct. Included in the kit are all the necessary contents for modifying BACs and all materials needed to perform a control experiment intended to familiarize you with this novel technique. Additionally, a vector converting any E.coli strain into competent strains for application with Red/ET Recombination is provided. pSC101-BAD-gbaAtet comes with a tetracyclin resistance cassette. This cassette contains a temperature sensitive origin of replication (ori) that can only propagate at 30°C - at 37°C the plasmid will be lost. This allows for simple removal of the plasmid when it is no longer needed. To introduce a mutation (i.e. a selection cassette like the neomycin resistance cassette included with this kit) you first have to introduce homology sequences to the selection cassette. This can be done through a simple PCR reaction. These short homologous sequences (50 nt each) can be freely chosen for your experimental needs. Simply choose the location to be modified and insert the selection cassette directly at the desired nucleotide with the Red/ET Recombination technology. The PCR product then needs to be electroporated in bacteria with the induced Red/ET Recombination system. After successful Red/ET Recombination the modified DNA can be recovered using conventional DNA mini-preparation methods.

Contents

  • pSC101-BAD-gbaA (tet) which is a derivative of pSC101 ori (a temperature sensitive origin) based Red/ET expression plasmid
  • BAC host carrying pSC101-BAD-gbaA (tet)
  • Positive control experiment for modifying a 150kb BAC (BAC clone in the host carrying pSC101-BAD-gbaA, neo PCR product for deletion in BAC backbone, BAC-neo clone in the host as positive recombinant)
  • Protocols, descriptions of plasmids, maps and sequences of oligos

Sequences

Tn5-kanR/neoR selection cassette

Tn5-Promoter
KanR/NeoR
TGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGA AGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAG GGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAA GATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATG ACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGC GCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCG CAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGA AGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCC ATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCAT TCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGG TCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAA CTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCC ATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATT CATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCT ACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGC TTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGA CGAGTTCTTCTGACTCGAG



Red/ET Training Courses

Next course: date to be announced
Details

Download Red/ET Brochure

Red/ET Brochure Gene Bridges' Red/ET Recombination brochure provides a comprehensive introduction to the technology and an overview on Red/ET related products and services.

Japanese Version

Publications

References

 

 

 

Terms & Conditions | Disclaimer | Top of Page
© 2024 Gene Bridges GmbH